-
Smedegaard McDermott opublikował 1 rok, 8 miesięcy temu
The AgNPs was tested against four pathogenic microorganisms S. epidermidis, S. aureus, E. coli and P. aeruginosa. The nanoparticles exhibited strong minimum inhibitory concentration (MIC) values of 12.5 and 6.25 µg/µl and minimum bactericidal concentration (MBC) values of 12.5 and 12.5 µg/mL against E. coli and P. aeruginosa, respectively. One distinguishing feature of AgNPs produced by Cedecea sp. extracts is their extreme stability. Inductively coupled plasma mass spectrometry and thermogravimetric analysis demonstrated that the produced AgNPs are stable for periods exceeding one year. This means that their strong antibacterial effects, demonstrated against E. coli and P. aeruginosa biofilms, can be expected to persist during extended periods.CRISPR/Cas9 represents a valuable tool to determine protein function, but technical hurdles limit its use in challenging settings such as cells unable to grow in vitro like primary leukemia cells and xenografts derived thereof (PDX). To enrich CRISPR/Cas9-edited cells, we improved a dual-reporter system and cloned the genomic target sequences of the gene of interest (GOI) upstream of an out-of-frame fluorochrome which was expressed only upon successful gene editing. To reduce rounds of in vivo passaging required for PDX leukemia growth, targets of 17 GOI were cloned in a row, flanked by an improved linker, and PDX cells were lentivirally transduced for stable expression. The reporter enriched scarce, successfully gene-edited PDX cells as high as 80%. Using the reporter, we show that KO of the SRC-family kinase LYN increased the response of PDX cells of B precursor cell ALL towards Vincristine, even upon heterozygous KO, indicating haploinsufficiency. In summary, our reporter system enables enriching KO cells in technically challenging settings and extends the use of gene editing to highly patient-related model systems.In the present study, we analyze a field-based seven-year data series of surface mass-balance measurements collected during 2011/12 to 2017/18 on Naradu Glacier, western Himalaya, India. The average annual specific mass balance for the said period is - 0.85 m w.e. with the maximum ablation of - 1.15 m w.e. The analysis shows that the topographic features, south and southeast aspects and slopes between 7 to 24 degrees are the reasons behind the maximum ablation from a particular zone. The causes of surface mass balance variability have been analyzed through multiple linear regression analyses (MLRA) by taking temperature and precipitation as predictors. The MLRA demonstrates that 71% of the observed surface mass balance variance can be explained by temperature and precipitation. It clearly illustrates the importance of summer temperature, which alone explains 64% variance of surface mass balance. The seasonal analysis shows that most of the surface mass balance variability is described by summer temperature and winter precipitation as two predictor variables. Among monthly combinations, surface mass balance variance is best characterized by June temperature and September precipitation.Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.Acoustic holograms are the keystone of modern acoustics. They encode three-dimensional acoustic fields in two dimensions, and their quality determines the performance of acoustic systems. Optimisation methods that control only the phase of an acoustic wave are considered inferior to methods that control both the amplitude and phase of the wave. In this paper, we present Diff-PAT, an acoustic hologram optimisation platform with automatic differentiation. We show that in the most fundamental case of optimizing the output amplitude to match the target amplitude; our method with only phase modulation achieves better performance than conventional algorithm with both amplitude and phase modulation. The performance of Diff-PAT was evaluated by randomly generating 1000 sets of up to 32 control points for single-sided arrays and single-axis arrays. This optimisation platform for acoustic hologram can be used in a wide range of applications of PATs without introducing any changes to existing systems that control the PATs. In addition, we applied Diff-PAT to a phase plate and achieved an increase of > 8 dB in the peak noise-to-signal ratio of the acoustic hologram.Electrical stimulation of the cerebral cortex (ESCC) has been used to treat intractable neuropathic pain for nearly two decades, however, no standardized approach for this technique has been developed. In order to optimize targeting and validate the effect of ESCC before placing the permanent grid, we introduced initial assessment with trial stimulation, using a temporary grid of subdural electrodes. In this retrospective study we evaluate the role of electrode location on cerebral cortex in control of neuropathic pain and the role of trial stimulation in target-optimization for ESCC. Location of the temporary grid electrodes and location of permanent electrodes were evaluated in correlation with the long-term efficacy of ESCC. The results of this study demonstrate that the long-term effect of subdural pre-motor cortex stimulation is at least the same or higher compare to effect of subdural motor or combined pre-motor and motor cortex stimulation. These results also demonstrate that the initial trial stimulation helps to optimize permanent electrode positions in relation to the optimal functional target that is critical in cases when brain shift is expected. Proposed methodology and novel results open a new direction for development of neuromodulation techniques to control chronic neuropathic pain.Mycelia, the vegetative part of fungi, are emerging as the avant-garde generation of natural, sustainable, and biodegradable materials for a wide range of applications. They are constituted of a self-growing and interconnected fibrous network of elongated cells, and their chemical and physical properties can be adjusted depending on the conditions of growth and the substrate they are fed upon. So far, only extracts and derivatives from mycelia have been evaluated and tested for biomedical applications. In this study, the entire fibrous structures of mycelia of the edible fungi Pleurotus ostreatus and Ganoderma lucidum are presented as self-growing bio-composites that mimic the extracellular matrix of human body tissues, ideal as tissue engineering bio-scaffolds. To this purpose, the two mycelial strains are inactivated by autoclaving after growth, and their morphology, cell wall chemical composition, and hydrodynamical and mechanical features are studied. Finally, their biocompatibility and direct interaction with primary human dermal fibroblasts are investigated. The findings demonstrate the potentiality of mycelia as all-natural and low-cost bio-scaffolds, alternative to the tissue engineering systems currently in place.The trade in falsified medicine has increased significantly and it is estimated that global falsified sales have reached $100 billion in 2020. The EU Falsified Medicines Directive states that falsified medicines do not only reach patients through illegal routes but also via the legal supply chain. Falsified medicines can contain harmful ingredients. They can also contain too little or too much active ingredient or no active ingredient at all. BARDS (Broadband Acoustic Resonance Dissolution Spectroscopy) harnesses an acoustic phenomenon associated with the dissolution of a sample (tablet or powder). The resulting acoustic spectrum is unique and intrinsic to the sample and can be used as an identifier or signature profile. BARDS was evaluated in this study to determine whether a product is falsified or genuine in a rapid manner and at lower cost than many existing technologies. A range of genuine and falsified medicines, including falsified antimalarial tablets from south-east Asia, were tested, and compared to their counterpart genuine products. Significant differences between genuine and falsified doses were found in their acoustic signatures as they disintegrate and dissolve. Principal component analysis was employed to differentiate between the genuine and falsified medicines. This demonstrates that the tablets and capsules included here have intrinsic acoustic signatures which could be used to screen the quality of medicines.In this paper, the distribution of relaxation times (DRTs) functions are calculated numerically in Matlab for synthetic impedance data from single parallel [Formula see text] circuit and two parallel [Formula see text] circuits connected in series, experimental impedance data from supercapacitors and α-LiFeO2 anode based Li ion batteries. The quality of the impedance data is checked with the Kramers-Krönig (KK) relations. The DRTs are calculated within the KK compatible regime for all the systems using Tikhonov regularization (TR) method. Here we use a fast and simple L-curve method to estimate the TR parameter (λ) for regularization of the Fredholm integral equations of first kind in impedance. Estimation of the regularization parameters are performed effectively from the offset of the global corner of the L-curve rather than simply using the global corner. The physical significances of DRT peaks are also discussed by calculating the effective resistances and capacitances coupled with peak fitting program. For instance, two peaks in the DRTs justify the electrical double layer capacitance and ion diffusion phenomena for supercapacitors in low to intermediate frequencies respectively. Moreover, the surface film effect, Li/electrolyte and electrode/electrolyte charge transfer related processes are identified for α-LiFeO2 anode based Li-ion batteries. This estimation of the offset of the global corner extends the L-curve approach coupled with the Tikhonov regularization in the field of electrochemistry and can also be applied in similar process detection methods.


